2003-04-16-世界卫生组织-SARS-CoV_specific_RT-PCR_primers_2页_10kb

SARS-CoV Specific RT-PCR Primers Summary

Core Content

This document outlines the development and application of RT-PCR primers for the detection and molecular analysis of SARS-related coronaviruses. It describes the design, use, and validation of both broadly reactive and SARS-specific primer pairs in the context of clinical specimen testing.

Main Points

• RNA Extraction Method: RNA was extracted from 100 μL of each specimen or culture supernatant using the automated NucliSens extraction system (bioMerieux).

• Primer Design: Primers were designed based on alignments of the open reading frame 1b (ORF1b) of the coronavirus polymerase gene sequences from multiple viral species, including:

  • Human coronaviruses: 229E (X69721), OC43 (AF124989)
  • Canine coronavirus (AF124986)
  • Feline infectious peritonitis virus (AF124987)
  • Porcine transmissible gastroenteritis virus (Z34093)
  • Porcine epidemic diarrhea virus (NC_003436)
  • Bovine coronavirus (NC_003045)
  • Porcine hemagglutinating encephalomyelitis virus (AF124988)
  • Sialodacryoadenitis virus (AF124990)
  • Mouse hepatitis virus (NC_001846)
  • Turkey coronavirus (AF124991)
  • Avian infectious bronchitis virus (NC_001451)

• Broadly Reactive Primer Pair: The primer pair IN-2 and IN-4 was designed to target conserved regions of ORF1b to ensure broad reactivity across the genus Coronavirus. These primers were used to amplify DNA from SARS isolates, and the resulting amplicons were used to design more specific primers for SARS-CoV.

• SARS-Specific Primers: The following three primers were used for specific amplification of SARS-CoV:

  • Cor-p-F2 (Forward): 5' CTAACATGCTTAGGATAATGG 3'
  • Cor-p-F3 (Forward): 5' GCCTCTCTTGTTCTTGCTCGC 3'
  • Cor-p-R1 (Reverse): 5' CAGGTAAGCGTAAAACTCATC 3'

• Testing Protocol:

  • Patient specimens were tested using these SARS-specific primers.
  • Primers for other respiratory viruses (e.g., human metapneumovirus, respiratory syncytial virus, parainfluenza viruses, influenza viruses, adenovirus, and picornavirus) were also used for comparison.
  • RNA integrity was confirmed using primers for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

• Amplification and Analysis:

  • One-step RT-PCR was performed using the Access RT-PCR System (Promega).
  • Amplified products were analyzed via capillary electrophoresis using an ABI 3100 Prism Genetic Analyzer and GeneScan software (version 3.1.2).
  • A specimen was considered positive for SARS-associated coronavirus if the amplification product size matched the expected size (368 nucleotides for Cor-p-F2/Cor-p-R1 or Cor-p-F3/Cor-p-R1) within 1 nucleotide and was confirmed by a second PCR reaction in a separate laboratory.

• Product Verification:

  • Where DNA yield was sufficient, amplified products were sequenced to verify their authenticity and confirm that they originated from SARS-CoV.

Key Information

• Purpose: To develop and validate specific RT-PCR primers for the detection of SARS-related coronaviruses in clinical specimens.
• Validation: Primers were validated using multiple viral species and confirmed through repeated testing in different laboratories.
• Control Measures: RNA integrity and RT-PCR inhibition were controlled by testing for GAPDH and using standardized viral RNA controls.
• Technology Used: Automated RNA extraction, one-step RT-PCR, capillary electrophoresis, and fluorescent labeling for product detection and analysis.

Conclusion

The document emphasizes the importance of designing primers that are both broadly reactive and specific for accurate detection of SARS-CoV. It outlines a rigorous testing protocol involving multiple controls, validation steps, and sequencing to ensure reliable and specific results in molecular analyses.